Hanarum, Sarenti (2021) Identifikasi Bakteri BLL-B Dari Kawasan Lumpur Lapindo Sidoarjo Dengan Pendekatan Pohon Filogenetik 16S-rRNA. Undergraduate thesis, Institut Teknologi Sepuluh Nopember.
|
Text
01211740000082-Undergraduate_Thesis.pdf - Accepted Version Restricted to Repository staff only until 1 October 2023. Download (1MB) | Request a copy |
Abstract
Penelitian dilakukan dengan mengisolasi bakteri dari sampel yang diambil pada kawasan Lumpur Lapindo Sidorajo yang merupakan salah satu lingkungan ekstrem. Isolat bakteri diambil pada koordinat 7° 31’48.0” Lintang Selatan dan 112° 42’ 37.7” Bujur Timur. Isolat BLL-B diregenerasi menggunakan media ISP2 dengan teknik streak. Pengamatan morfologi sel dan karakterisasi pada bakteri BLL-B didapatkan bahwa bakteri memiliki gram negatif, berbentuk batang, berwarna putih kekuningan dan memiliki kemampuan resistan terhadap antibiotik ampicilin 50 ppm. Isolat BLL-B diisolasi untuk mendapatkan DNA yang akan digunakan untuk analisa sekuens gen 16S-rRNA fragmen bakteri dengan menggunakan forward primer 27F(5’- AGAGTTTGATCATGGCTCAG 3') dan reverse primer 1492R(5'CACGGATCCTACGGGTACCTTGTTACGACTT 3')
menggunakan alat PCR. Elektroforesis dilakukan dengan menggunakan gel agarose 2% dengan hasil menunjukkan bahwa berat molekul ±1300 bp. Hasil urutan nukleotida DNA yang diperoleh dibandingkan dengan database yang ada pada NCBI menggunakan fitur BLAST. Berdasarkan hasil pohon filogenetik diperoleh bahwa isolat BLL-B memiliki kemiripan dengan prosentase sebesar 97,25% dengan Chryseobacterium sp.
================================================================================================
Sidoarjo hot mud has been known for its massive disaster in May 2006 and the flow itself has continuously flooding up until these current days. Previous research had been done to investigate the indigenous bacteria coming from the depth of the mud flow, however the complete biodiversity of the bacteria samples is still far from end. Therefore, this research aims to isolate, discover, and characterize those bacteria taken from Hot Mud Flow site using different technique of cultivation. These isolate bacteria, presuming extremophiles, were taken near the core of the hot mud. One of the isolates, BLL-B, was regenerated using ISP2 media and recultivated to produce pure culture. Observation of cell morphology and characterization of BLL-B bacterium showed that it was gram negative, rod shaped, yellowish white in colour, rod shaped, and was resistant to 50 ppm ampicillin. DNA of BLL-B isolate was extracted and analysed using PCR to obtain 16S-rRNA fragments. The molecular weight of the DNA was determined at 1300 bp. Based on the results of the DNA alignment, BLL-B isolate had 97.25% similarities with Chryseobacterium sp.
| Item Type: | Thesis (Undergraduate) |
|---|---|
| Uncontrolled Keywords: | Lumpur Lapindo Sidoarjo, Ekstermofilik, Gen 16s- rRNA, PCR, Pohon Filogenetik, Mud Volcano Sidoarjo, Ekstermofilik, Gen16S-rRNA, PCR, Phylogenetic Tree |
| Subjects: | Q Science Q Science > QD Chemistry Q Science > QD Chemistry > QD251.2 Chemistry, Organic. Biochemistry |
| Divisions: | Faculty of Science and Data Analytics (SCIENTICS) > Chemistry > 47201-(S1) Undergraduate Thesis |
| Depositing User: | Sarenti Hanarum |
| Date Deposited: | 24 Aug 2021 05:19 |
| Last Modified: | 24 Aug 2021 05:19 |
| URI: | http://repository.its.ac.id/id/eprint/89247 |
Actions (login required)
![]() |
View Item |
